Supply List

• Thermal cycler

• Centrifuge

• Gel electrophoresis setup

• 2 micropipettes: 1-10 µl, 20-200 µl

• Scale for very small amounts to measure out agar powder

• Regular kitchen scale for weighing TBE buffer which you’ll use to make a gel block

MISC

• Permanent marker

• Tweezers with sharp tips

• Waste container

• Tube rack

• Large-ish glass cup for boiling agarose and buffer

• Strips of aluminum foil for mixing loading dye and fungal DNA before loading into gel

CONSUMABLES

• Lots of 10µl and 200µl pipette tips, loose or in boxes (buy 1000 loose in bulk on eBay to refill boxes)

• burn larger pipette tips to be used as pestles (one per sample)

• Two 0.2 ml tubes per sample (loose)

• Eight 0.2ml tubes in a strip - one strip for eight samples - MC Lab wants their samples in a strip, GeneWiz doesn’t

• One 1.7ml tube (to pre-mix mastermix, primers and distilled water)

• Two disposable non-powdered gloves (box of 100)

REAGENTS

• Distilled water

• 0.5M NaOH - buy as crystals and dissolve - this will last you forever. To make 0.5M NaOH, measure out 5g of sodium hydroxide and dissolve it in 250ml of distilled water

• Tris 8.0ph buffer - this is needs to be diluted 1:10

• Mastermix (the ODIN or IBI Scientific) - keep tube upright in a small rack in a closed plastic bag in freezer

• ITS1 and ITS4 primers (the ODIN, or IDT or GeneWiz especially for custom primers), store them like Mastermix. There are other primers, eg ITS4-B for basidiomycetes only (good if there might be mold contamination), but you’ll need to get them custom-mixed (GeneWiz or IDTDNA). I’ve recently been using ITS1_KYO instead of the straight ITS1 (TAGAGGAAGTAAAAGTCGTAA, custom order by GeneWiz)

• Optional (tip from Damon Tighe): DMSO which can make for longer sequences

• Agarose powder 

• TBE buffer (miniPCR, came with kit but available elsewhere) - concentrate can stay at room temperature

• Gel stain (miniPCR, came with kit, but available elsewhere) - can stay at room temperature

• Loading dye (the ODIN) - keep in a small reagent rack in plastic bag in freezer

• Small glass of isopropyl alcohol to sterilize hands, tweezers etc throughout (drugstore)

GenBank

Download Trace Files from GeneWiz

Use Snapgene to look at the Trace file

Verify the trace is good using BLAST

Submit to Genbank so it is available to everyone

Make phylogenetic trees to make useful data

Trace file is a chromatogram.

Primers ITS-1F (“f” stands for fungal) and ITS-4B (“4b” stands for basidiomycete).

Use SnapGene to trim and edit trace files, copy to clip board.

Go to NCBI BLAST https://blast.ncbi.nlm.nih.gov/Blast.cgi and click on Nucleotide BLAST.

Paste in data from chromatogram into query box.

Change ‘Search Set’ from Human collection to ‘Neucleotide Collection (nr/nt)’

Click BLAST to begin searching.

After data comes back scroll down and see how many listings use the same number of data points by checking the ‘Query Cover’ percentage. If using a longer primer like ITS-4B your matches may only be 80%. That is because you had more sequence data points. If the percentage reads 100% that means you have the same number of data points, or the other listing had more data points than you. Only look at sequences that are 60% or above for reliable matches.

Sort data by ‘Per. Ident’ and that shows how many bases in your sequence overlap other sequences.

Look at highest percentage with highest query cover rates to find a potential match. Finding a new species is subjective and will need further study.

Find differences and double check your chromatogram for potential problems.

Next submit the sequence with name to GenBank.

Open Note Pad and create a FASTA File.

> Mushroom name

Paste sequence…

Save File As “species.FAS'“

Open GenBank Submission Portal https://submit.ncbi.nlm.nih.gov

Eukaryotic Nuclear rRNA/ITS

Contains rRNA/ ITS region.

Required Field “Isolate”

Add name or higher classification… try and be as specific in ID. If unsure type Genus cf. species (cf. = “confer to” because no name matches better)

In Isolate field make sure to add iNat#9999999

Add field “country”

In field box type “USA: State, City, Location”

Add field “Isolation-Source”

In field box type “substrate”

Add field “Collected By”

In field box type name

Add field “Collection Date”

Add date

Add field “Primer”

Click Continue

Add Your Name

Click unpublished

Submit the sequence!